[Jprogramming] Split on first found character

[Mike Day]

That's quite nice.

Looking at the genetic coding examples on the website Jan-Pieter
mentioned,  and bearing in mind that "cut" is a provided verb,
this might be the sort of thing he would like:
NB. script version of defining some taxons:

sample =: 0 : 0 NB. truncated lines from web example

 >Taxon1

CCTGCGGAAGATCGGCAC

TCCCACTAATAA

 >Taxon2

CCATCGGTAGC

ATATCCATTTGTCAGCAGAC

 >Taxon3

CCACCCTCGT

TGGGAACCT

)

    >({.,<@;@}.)@(LF&cut)each '>' cut sample
+------+-------------------------------+
|Taxon1|CCTGCGGAAGATCGGCACTCCCACTAATAA |
+------+-------------------------------+
|Taxon2|CCATCGGTAGCATATCCATTTGTCAGCAGAC|
+------+-------------------------------+
|Taxon3|CCACCCTCGTTGGGAACCT            |
+------+-------------------------------+

NB. these boxes might not display nicely - sorry -
they look ok to me!


If the file is very large,  some buffering might be necessary.

Any use?

Mike

On 25/11/2014 10:47, Jan-Pieter Jacobs wrote:
> I think I would solve it like this (with intermediate steps):
>
> x=: 'case_id', LF, 'GCTAGTCG', LF, 'ACGTC', LF
>
> NB. Find the locations of LF's in the string
> (LF = ]) x
>
> NB. assign 0 to everything before the LF, assign 1 to everything after it
> ([: +./\  LF = ]) x
>
> NB. The wonderful "key" adverb lets you apply verbs based on it's key
> (another array), eg. box
> (</.~ [: +./\ LF =]) x
>
> NB. Get rid of the LF's by replacing < by a version removing LF:
> ((<@#~ LF~:])/.~ [: +./\ LF = ]) x
>
> This is what I came up with, but smarter people will probably suggest more
> elegant ways.
>
> I hope this is useful.
> Jan-Pieter
>
> 2014-11-25 11:00 GMT+01:00 Ryan <reckbo at bwh.harvard.edu>:
>
>> I have a character array with LF's, and want to split it on the
>> first LF, and remove the remaining LF's.  I'm wondering if there's a
>> simpler
>> way than what I'm doing now:
>>
>> x=: 'case_id', LF, 'GCTAGTCG', LF, 'ACGTC', LF
>>
>> filterLF=: #~ ~:&LF
>> headLF=: {.~ i.&LF
>> tailLF=: }.~ i.&LF
>> (headLF ; filterLF at tailLF) x
>> ┌────────┬─────────────┐
>> │>case_id│GCTAGTCGACGTC│
>> └────────┴─────────────┘
>>
>> (I'm reading text files in fasta format: http://rosalind.info/glossary/
>> fasta-format/)
>>
>> Thanks for any suggestions,
>> Ryan
>>
>>
>>


---
This email has been checked for viruses by Avast antivirus software.
http://www.avast.com



-----
No virus found in this message.
Checked by AVG - www.avg.com
Version: 2014.0.4794 / Virus Database: 4189/8623 - Release Date: 11/24/14